View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15697_high_8 (Length: 305)
Name: NF15697_high_8
Description: NF15697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15697_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 29 - 280
Target Start/End: Original strand, 23617296 - 23617547
Alignment:
| Q |
29 |
tgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatgtcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataa |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23617296 |
tgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatgtcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataa |
23617395 |
T |
|
| Q |
129 |
tgaaaacatgcaacagagaatccctaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttccactgcatccaactggcatattg |
228 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23617396 |
tgaaaacatgcaacagagaatcctaaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttcctctgcatccaactggcatattg |
23617495 |
T |
|
| Q |
229 |
gaagggaaatcaactgaccaggtgtcttctagtgtttcagtttcagctgata |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
23617496 |
gaagggaaatcaactgaccaggtgtcttctattgtttcagtttctgctgata |
23617547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University