View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15697_high_8 (Length: 305)

Name: NF15697_high_8
Description: NF15697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15697_high_8
NF15697_high_8
[»] chr4 (1 HSPs)
chr4 (29-280)||(23617296-23617547)


Alignment Details
Target: chr4 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 29 - 280
Target Start/End: Original strand, 23617296 - 23617547
Alignment:
29 tgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatgtcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataa 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23617296 tgcttctacctgcagtaggttatagaaggaaccatgctgagaaagttatgtcaaactcaaatggcatgtcaaatatctgcaatagtccaatggtatataa 23617395  T
129 tgaaaacatgcaacagagaatccctaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttccactgcatccaactggcatattg 228  Q
    |||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
23617396 tgaaaacatgcaacagagaatcctaaaccctaattatgactttggttacagtaatcaagaaacattggatttgtttcctctgcatccaactggcatattg 23617495  T
229 gaagggaaatcaactgaccaggtgtcttctagtgtttcagtttcagctgata 280  Q
    ||||||||||||||||||||||||||||||| |||||||||||| |||||||    
23617496 gaagggaaatcaactgaccaggtgtcttctattgtttcagtttctgctgata 23617547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University