View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15697_high_9 (Length: 261)
Name: NF15697_high_9
Description: NF15697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15697_high_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 28751188 - 28751432
Alignment:
| Q |
1 |
taaaattaacagtttaaaaaattgaacaaaatgcagtatgagtattactttacacggtatttcctatgcattgaaaagatagactgtttttgtttctttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28751188 |
taaaattaacagtttaaaaaattgaacaaaatgcagtatgagtattactttacacggtatttcctatgcattgaaaagatagactgtttttgtttctttg |
28751287 |
T |
 |
| Q |
101 |
gtttgactccaaagataaatgaccttagaggaacagcgttcttcgaatccgaaggtctcgtctggtttctcttggaatttgacagtccaaatttttcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28751288 |
gtttgactccaaagataaatgaccttagaggaacagcgttcttcgaatccgaaggtctcgtctggtttctcttggaatttgacagtccaaatttttcatt |
28751387 |
T |
 |
| Q |
201 |
caactttgcaagagccttctcagcatcaagttgaagagttgttac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28751388 |
caactttgcaagagccttctcagcatcaagttgaagagttgttac |
28751432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 90 - 134
Target Start/End: Original strand, 13747229 - 13747273
Alignment:
| Q |
90 |
ttgtttctttggtttgactccaaagataaatgaccttagaggaac |
134 |
Q |
| |
|
||||||||||||||| || ||||||||||||| ||| |||||||| |
|
|
| T |
13747229 |
ttgtttctttggtttcacaccaaagataaatgtcctgagaggaac |
13747273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University