View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15698_high_29 (Length: 217)
Name: NF15698_high_29
Description: NF15698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15698_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 19 - 115
Target Start/End: Complemental strand, 11610555 - 11610459
Alignment:
| Q |
19 |
caacccacgagaggggaatcttgcatataagtttatggttgaccttaacaaaaaatgatatgactatgggaaatattagaccctacttatttcattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| ||||||||| |||||||||||||||| |||| ||||| |
|
|
| T |
11610555 |
caacccacgagaggggaatcttgcatataagtttacggttgaccctaacaaaaaatgatgtgactatggtaaatattagaccctacgtattccattt |
11610459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 139 - 188
Target Start/End: Complemental strand, 11610237 - 11610188
Alignment:
| Q |
139 |
ttaaggagagaatgacactaatattggctaatttaattatgacttataaa |
188 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
11610237 |
ttaaggagagaacgacgctaacattggctaatttaattatgacttataaa |
11610188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University