View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15698_low_24 (Length: 299)
Name: NF15698_low_24
Description: NF15698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15698_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 161; Significance: 7e-86; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 10 - 178
Target Start/End: Original strand, 50571158 - 50571326
Alignment:
| Q |
10 |
attatactttatgattttgattttattatcagattagattagattctctctcccacagccacgacactctttttacaaaattgaatcaaccaacatccac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50571158 |
attatactttatgattttgattttattatcagattagattagatactctctcccacagccacgacactctttttacaaaattgaatcaaccaacatccac |
50571257 |
T |
 |
| Q |
110 |
cacctttatgttatgattcaattaataaataattgtcacacatctttttcatcgaaattttagtcacac |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
50571258 |
cacctttatgttatgattcaattaataaataattgtcacacatctttttcatcgaaatttttgtcacac |
50571326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 248 - 288
Target Start/End: Original strand, 50571400 - 50571440
Alignment:
| Q |
248 |
gtgaaaatcttgataccaaaccctttggtttttgagcagtg |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50571400 |
gtgaaaatcttgataccaaaccctttggtttttgagcagtg |
50571440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University