View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15698_low_29 (Length: 239)
Name: NF15698_low_29
Description: NF15698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15698_low_29 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 5451099 - 5451320
Alignment:
| Q |
1 |
atcattaattttgttgagtttatgtatgagtgattggtcaaaacgtcaattataaatttac-acatcttaaattctccttgtacctaatgtcttaatgnn |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5451099 |
atcattaattttgttgagtttatgtatgagtgattggtcaaaacgtcaattataaatttactacatcttaaattctccttgtacctaatgtcttaatgtt |
5451198 |
T |
|
| Q |
100 |
nnnnngcggagatgaatgttcctcttgtggtaccgaatcattaatccctcattgttccatgctatctctttgattcccggacaaatcagtgagtaaggta |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
5451199 |
tttttgcggagataaatgttcctcttgtggtaccgaatcattaatccctcattgttccatgctatctctttgattcccggacaaatcagtgagtaagtta |
5451298 |
T |
|
| Q |
200 |
ccaatttctttggagatgttgc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
5451299 |
ccaatttctttggagatgttgc |
5451320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University