View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15698_low_30 (Length: 238)
Name: NF15698_low_30
Description: NF15698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15698_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 45042257 - 45042463
Alignment:
| Q |
14 |
tagtaaattagtaatataaatacatttcaaatatcaaatgttgctagctataccgagtggatgcaaggagttcaaacaaattatttttatcctggatttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45042257 |
tagtaaattagtaatataaatacatttcaaatatcaaatgttgctagcta--ccgagtggatgcaaggagttcaaacaaattatttttatcctggatttg |
45042354 |
T |
 |
| Q |
114 |
aagagtaatgtagactcttttattatgttagtcaatgatagaaccgaggtagttccatttaaaatagatgttgtagcactttatcataacaactcttatg |
213 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45042355 |
aagagtaatgtagactcttttattctgttagtcaatgatagaaccgaggtagttccatttaaaatagatgttgtagcactttatcataacaactcttatg |
45042454 |
T |
 |
| Q |
214 |
tcgagtttt |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
45042455 |
tcgagtttt |
45042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University