View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15698_low_32 (Length: 211)
Name: NF15698_low_32
Description: NF15698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15698_low_32 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 85 - 211
Target Start/End: Original strand, 45041451 - 45041576
Alignment:
| Q |
85 |
cggattcaacattagttcactcctacattacaattctggtatgtgaaannnnnnnngttttattaatcttcctgaaaaactataattaacattcccgtta |
184 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45041451 |
cggattcaacattagttcacccctacattccaattctggtatgtgaaattttttt-gttttattaatcttcttgaaaaactataattaacattcccgtta |
45041549 |
T |
|
| Q |
185 |
ttctatttattgtcggaaagctataaa |
211 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
45041550 |
ttctatttattgtcggaaagctataaa |
45041576 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 45041348 - 45041382
Alignment:
| Q |
1 |
aattttataatgtacccctgcaattcactaaaatg |
35 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45041348 |
aattttataatgtacccctacaattcactaaaatg |
45041382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University