View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_high_10 (Length: 312)
Name: NF15699_high_10
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_high_10 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 22 - 147
Target Start/End: Original strand, 20745459 - 20745584
Alignment:
| Q |
22 |
gtaccgattgaggaaaaataaaattagtcaccgctaacttttctagtgtgtttcaaattactaatagaaaactttttaatcatagatctatgtatttcta |
121 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
20745459 |
gtaccgattgaggaaaaaccaaattagtcaccgctaacttttctagtgtgtttcaaattactaatagaaaactttttaatcatatatctaggtatttcta |
20745558 |
T |
|
| Q |
122 |
atacttttaattcttaataaacttta |
147 |
Q |
| |
|
|||| ||||||||||||||||||||| |
|
|
| T |
20745559 |
atacctttaattcttaataaacttta |
20745584 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 224 - 263
Target Start/End: Complemental strand, 33020893 - 33020855
Alignment:
| Q |
224 |
catgtcttgattttgatgaattattaaattaattccaaca |
263 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33020893 |
catgtcttg-ttttgatgaattattaaattaattccaaca |
33020855 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University