View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_high_16 (Length: 273)
Name: NF15699_high_16
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 265
Target Start/End: Complemental strand, 12912529 - 12912278
Alignment:
| Q |
18 |
tgaatttggtctttagatcttaacctcagtcagttcagcagagagc----agtacaagttaccctgtcatggtactgtgtgtatgaagttacaagttttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12912529 |
tgaatttggtctttagatcttaacctcagtcagttcagcagagagcgcgcagtacaagttaccctgtcatggtactgtgtgtatgaagttacaagttttg |
12912430 |
T |
 |
| Q |
114 |
catatacatatatggtaaattacacaaattttaccgtggtctattttaatacatggtataaatttggctccgttacggttacactatagaaaaataannn |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
12912429 |
catatacatatatggtaaattacacaaattttaccgtggtctattttaatacatggtataaatttggctccgttacggttacactagagaaaaataatat |
12912330 |
T |
 |
| Q |
214 |
nnnngatcatggccttttgtggtttgatgtagccgttgcgttcattatatat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
12912329 |
ttgtgatcatggccttttgtggtttgatgtagccgttgtgttcagtatatat |
12912278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University