View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_high_5 (Length: 422)
Name: NF15699_high_5
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 306 - 405
Target Start/End: Complemental strand, 35298491 - 35298389
Alignment:
| Q |
306 |
ttagccttctcaaatagatggatctatatcgactatt---gtgttgtgtcttcgcaatgttagcatggttattttgtaattggttatgagtatccctttt |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35298491 |
ttagccttctcaaatagatggatctatatcgactattattgtgttgtgtcttcgcaatgttagcatggttattttgtaattggttatgagtatccctttt |
35298392 |
T |
 |
| Q |
403 |
aat |
405 |
Q |
| |
|
||| |
|
|
| T |
35298391 |
aat |
35298389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 308
Target Start/End: Complemental strand, 12877567 - 12877523
Alignment:
| Q |
264 |
ccttgattttggtttttctgtagggaaggtaggaacaaaaattta |
308 |
Q |
| |
|
||||||| ||||||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
12877567 |
ccttgatcttggtttatctttagagaaggtaggaacaaaaattta |
12877523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University