View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_low_15 (Length: 286)
Name: NF15699_low_15
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 271
Target Start/End: Complemental strand, 15406889 - 15406631
Alignment:
| Q |
18 |
taatcaaggtatatatcttcctttgcatagttctaaattgtagtatgcaacagtagttcggttttgcaagaatgagttaggccaaatttcaacggtttta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15406889 |
taatcaaggtatatatcttcctttgcatagttctaaattgtagtatgcaacagtagttcggttttgcaagaatgagttaggccaaatttcaacggtttta |
15406790 |
T |
 |
| Q |
118 |
gaagtctttataatttgtccacattttatttttaatataaggttcacagcgtaactgcaactgcaatcctaatcgaaataactttg--ttgaa---tann |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| | |
|
|
| T |
15406789 |
gaagtctttataatttgtccacattttatttttaatataaggttcacagcgtaactgcaactgcaattttaatcgaaataactttgtattgaattttttt |
15406690 |
T |
 |
| Q |
213 |
nnnnnncagaagtcaaactagtccatcgaaattgtgtattgaaaagggtcattggctat |
271 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
15406689 |
tcttttcagaagtcaaattagtccgtcgaaattgtgtattgaaaagggtcattggctat |
15406631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University