View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_low_18 (Length: 229)
Name: NF15699_low_18
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 17 - 141
Target Start/End: Original strand, 24424338 - 24424462
Alignment:
| Q |
17 |
aaggcagtgaaacttgaaacaaccaaaatacttgactgtcctaaggctactggaagtttgagagaaatgtaggtgacttctatttcctacctaccaggaa |
116 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24424338 |
aaggcagtgaaacttgaaacaaacaaaatacttgactgtcctaaggctactggaagtttgagagaaatgtaggtgacttctatttcctacctaccaggaa |
24424437 |
T |
|
| Q |
117 |
tactgacacaaaccatctaccatta |
141 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24424438 |
tactgacacaaaccatctaccatta |
24424462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 164 - 213
Target Start/End: Original strand, 24424493 - 24424542
Alignment:
| Q |
164 |
cccctacaggttttgaaaaacataataattgcaaacaacaacatttgcat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24424493 |
cccctacaggttttgaaaaacataataattgcaaacaacaacatttgcat |
24424542 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University