View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_low_21 (Length: 221)
Name: NF15699_low_21
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 12 - 220
Target Start/End: Complemental strand, 36840696 - 36840488
Alignment:
| Q |
12 |
aagcaaaggctcaggtgagaacaagattgtacgtgatgtccacttatgccttaagtgcttcattattttcatcaacttaatttgcattgtggtgtgattt |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36840696 |
aagcaaaggctcaggtgagaacaagattgtacgtgatgtccacttatgccttaagtgcttcattattttcatcaacttaatttgcattgtggtgtgattt |
36840597 |
T |
|
| Q |
112 |
ctagttttctactgaattcaattagtctttatgtttaacttctcttattattatcaactttctgcagaatcttttatgtggaaaaaacttaaaagttgac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36840596 |
ctagttttctactgaattcaattagtctttatgtttaacttctcttattattatcaactttctgcagaatcttttatgtggaaaaaacttaaaagttgac |
36840497 |
T |
|
| Q |
212 |
caaagcatc |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
36840496 |
caaagcatc |
36840488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 156 - 220
Target Start/End: Complemental strand, 36829349 - 36829285
Alignment:
| Q |
156 |
ttattattatcaactttctgcagaatcttttatgtggaaaaaacttaaaagttgaccaaagcatc |
220 |
Q |
| |
|
|||||| |||||||||||||| ||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
36829349 |
ttattaatatcaactttctgctgaatcttttatatgaaaaatacttaaaagttgaccaaagcatc |
36829285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University