View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15699_low_22 (Length: 221)
Name: NF15699_low_22
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15699_low_22 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 34960703 - 34960911
Alignment:
| Q |
13 |
cttgttcttttcggtgacaaaatgagtcattccgtgacattagttaagttagtactttgtagtttgtagagaggaacactaacatctaaataaattgata |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34960703 |
cttgttcttttcggtgacaaaatgagtcattccgtgacattagttaagttagtactttgtagtttgtagagaggaacactaacatctaaataaattgata |
34960802 |
T |
|
| Q |
113 |
gtaacctctaacgtaactatcgatcacaggcaaagaaggaacatgacacgataaggcaccgatgannnnnnngaacaaaatagaagctacagtcacacac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34960803 |
gtaacctctaacgtaactatcgatcacaggcaaagaaggaacatgacacgataaggcaccgatgatttttttgaacaaaatagaagctacagtcacacac |
34960902 |
T |
|
| Q |
213 |
tcattcatc |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
34960903 |
tcattcatc |
34960911 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University