View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15699_low_5 (Length: 422)

Name: NF15699_low_5
Description: NF15699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15699_low_5
NF15699_low_5
[»] chr3 (1 HSPs)
chr3 (306-405)||(35298389-35298491)
[»] chr5 (1 HSPs)
chr5 (264-308)||(12877523-12877567)


Alignment Details
Target: chr3 (Bit Score: 89; Significance: 9e-43; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 306 - 405
Target Start/End: Complemental strand, 35298491 - 35298389
Alignment:
306 ttagccttctcaaatagatggatctatatcgactatt---gtgttgtgtcttcgcaatgttagcatggttattttgtaattggttatgagtatccctttt 402  Q
    |||||||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35298491 ttagccttctcaaatagatggatctatatcgactattattgtgttgtgtcttcgcaatgttagcatggttattttgtaattggttatgagtatccctttt 35298392  T
403 aat 405  Q
    |||    
35298391 aat 35298389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 264 - 308
Target Start/End: Complemental strand, 12877567 - 12877523
Alignment:
264 ccttgattttggtttttctgtagggaaggtaggaacaaaaattta 308  Q
    ||||||| ||||||| ||| ||| |||||||||||||||||||||    
12877567 ccttgatcttggtttatctttagagaaggtaggaacaaaaattta 12877523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University