View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1569_high_19 (Length: 237)
Name: NF1569_high_19
Description: NF1569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1569_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 18 - 127
Target Start/End: Complemental strand, 16479874 - 16479765
Alignment:
| Q |
18 |
atgggtgctcataatccatttggtgatcctttacctgttgctagttatcctcataattctatgccccagcaaggaaattacaatttaatgtagagttttc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
16479874 |
atgggtgctcataatccatttggtgatcctttacctgttgctagttaccctcataattctatgccgcagcaaggaaattacaatttaatgtagagttttc |
16479775 |
T |
|
| Q |
118 |
cttttacttg |
127 |
Q |
| |
|
|||||||||| |
|
|
| T |
16479774 |
cttttacttg |
16479765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 188 - 237
Target Start/End: Complemental strand, 16479701 - 16479652
Alignment:
| Q |
188 |
agttatcaataatttgttttagataaacttttcattgcctagatatatcc |
237 |
Q |
| |
|
||||||||||||||| | ||||||||||||||| |||||||||||||||| |
|
|
| T |
16479701 |
agttatcaataatttatattagataaacttttccttgcctagatatatcc |
16479652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University