View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1569_low_17 (Length: 272)
Name: NF1569_low_17
Description: NF1569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1569_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 47 - 255
Target Start/End: Complemental strand, 38326832 - 38326624
Alignment:
| Q |
47 |
tcctaatattcgatttggttcaaattttannnnnnnncaacaacaatcttagttatttgatacaattcggcttaaaaactagttcgattcnnnnnnntac |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |
|
|
| T |
38326832 |
tcctaatattcgatttggttcaaattttattttttttcaacaacaatcttagttatttgatacaattcggcttaaaaaccagttcgattcaaaaaaatac |
38326733 |
T |
 |
| Q |
147 |
attccaatttttgtaaaggtaattttggttcagcttgaaactacataaccagtgcaccaaatctctcgcaattcggtttgtgacgaatcagtaacggctt |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38326732 |
attccaatttttgtaaaggtaattttggttcagcttgaaactacataaccaatgcaccaaatctctcgcaattcagtttgtgacgaatcagtaacggctt |
38326633 |
T |
 |
| Q |
247 |
ggttctgtg |
255 |
Q |
| |
|
||||||||| |
|
|
| T |
38326632 |
ggttctgtg |
38326624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University