View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1569_low_19 (Length: 244)
Name: NF1569_low_19
Description: NF1569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1569_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 41103022 - 41102797
Alignment:
| Q |
1 |
cctgcagaatgcaaaacacttcatgtccacatcgacctgaggaaaatctctgttgtggaaaggaagcgtaattgcgtaaacaccttctaaatgcatctag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41103022 |
cctgcagaatgcaaaacacttcatgtccacatcgacctgaggaaaatctctgttgtggaaaggaagcgtaa--------acaccttctaaatgcatctag |
41102931 |
T |
|
| Q |
101 |
agtgaatctgtcttaactgacactttcttaataaacggaacaccatcgcctatattgcaaaatagatccccttttgaactggtgtttgacaaatcagcta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41102930 |
agtgaatctgtcttaactgacactttcttaataaacggaacaccgtcgcctatattgcaaaatagatccccttttgaactggtgtttgacaaatcagcta |
41102831 |
T |
|
| Q |
201 |
attatagtggccttcgcatatttggttgcctatg |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
41102830 |
attatagtggccttcgcatatttggttgcttatg |
41102797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 41080623 - 41080578
Alignment:
| Q |
1 |
cctgcagaatgcaaaacacttcatgtccacatcgacctgaggaaaa |
46 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||| |||| |
|
|
| T |
41080623 |
cctgcagaatgcaaaacacgtcatgtccacatcgacatgagaaaaa |
41080578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 192
Target Start/End: Complemental strand, 1216276 - 1216186
Alignment:
| Q |
102 |
gtgaatctgtcttaactgacactttcttaataaacggaacaccatcgcctatattgcaaaatagatccccttttgaactggtgtttgacaa |
192 |
Q |
| |
|
||||||| | |||||||| |||||| |||||| ||||||| | |||||||||||||||||| ||| ||||| |||| |||||||||| |
|
|
| T |
1216276 |
gtgaatcggccttaactgccacttttcctataaacagaacaccgttacctatattgcaaaatagacccctttttggactgttgtttgacaa |
1216186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University