View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1569_low_26 (Length: 233)
Name: NF1569_low_26
Description: NF1569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1569_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 10 - 219
Target Start/End: Original strand, 3989531 - 3989740
Alignment:
| Q |
10 |
ccaagaatatatttctgtctgaagcctcaaacatggcgattgtgacaggccctaatatgtaagaaaatatttgtttcacgttaaaggataactgttcaca |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3989531 |
ccaacaatatatttctgtctgaagcctcaaacatggcgattgtgacaggccctaatatgtaagaaaatatttgtttcacgttaaaggataactgttcata |
3989630 |
T |
 |
| Q |
110 |
ccggagattgatggcagtgaaattctagatgaactttaactgacatagacaatgactatccacgagtcatgactaaattcttttggtaagaaaacggaag |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3989631 |
ccggagattgatggcagtgaaattctagacgaactttaactgacatagacaatgactatccacgagtcatgactaaattcttttggtaagaaaacggaag |
3989730 |
T |
 |
| Q |
210 |
tgcgtatgtg |
219 |
Q |
| |
|
|||||||||| |
|
|
| T |
3989731 |
tgcgtatgtg |
3989740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University