View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15700_low_6 (Length: 248)
Name: NF15700_low_6
Description: NF15700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15700_low_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 17 - 81
Target Start/End: Original strand, 3263978 - 3264042
Alignment:
| Q |
17 |
aatatcgataaaacaagccaaattagtttgaaaaataggactaccttacacatgagctaaactat |
81 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3263978 |
aatatcgataaaacaagccaaattagtttgaaaaataggactaccttacacatgagctaaactat |
3264042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 138
Target Start/End: Complemental strand, 27736348 - 27736249
Alignment:
| Q |
38 |
attagtttgaaaaataggactaccttacacatgagctaaactattgcaaatatcactaaaacattgcaaatgaattaattcatcgaataagtaattgtat |
137 |
Q |
| |
|
||||||| |||| ||||| ||| ||| |||| | || ||||||||||||| |||||||||| | ||||||| |||||||| ||| || |||| ||| ||| |
|
|
| T |
27736348 |
attagttcgaaatatagggctatctttcacacgtgccaaactattgcaaagatcactaaaa-aatgcaaattaattaattaatcaaacaagtgattatat |
27736250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University