View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15701_low_2 (Length: 454)
Name: NF15701_low_2
Description: NF15701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15701_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 375; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 375; E-Value: 0
Query Start/End: Original strand, 10 - 437
Target Start/End: Original strand, 47894150 - 47894595
Alignment:
| Q |
10 |
aagaaaatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894150 |
aagaaaatctcgatacggtgtcccaccggtgaacgtgagggaattagttggcttcatgaggagtgttagggttgatgaatggagtccggtgtctaagatg |
47894249 |
T |
|
| Q |
110 |
ggttct------------------ccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc |
191 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894250 |
ggttctgtgtttggttctccacgaccacgaggtggttttttgagtcttccatcaaactatgaaggggttggtatggagagggtggaatcaggaagagatc |
47894349 |
T |
|
| Q |
192 |
ttagagccaaaatctatgcgaaatttggtaggttgaactcaaacgatggtgttgtttcggtccctgtccctgatattggatgggttgcggaacttgttaa |
291 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894350 |
ttagagccaaaatctatgagaaatttggtaggttgaactcaaacgatggtgttgtttcggtccctgtccctgatattggatgggttgcggaacttgttaa |
47894449 |
T |
|
| Q |
292 |
ctgaatctggatggaagagtatgattttactttgtatagttgaatgatgcaaaaagaaataaaacagctctctgtgcattgttgaggagtatggcttttt |
391 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47894450 |
ctgaatctggatggaagagtatgattttactttgtatagttgaatgatgcaaaaagaaataaaacagctctctgtgcattgttgaggagtatggcatttt |
47894549 |
T |
|
| Q |
392 |
ggtgtctctgtatctgttttcttaattccttttgacatttaggttt |
437 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47894550 |
ggtgtctctatatctgttttcttaattccttttgacatttaggttt |
47894595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University