View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15701_low_5 (Length: 269)
Name: NF15701_low_5
Description: NF15701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15701_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 4 - 251
Target Start/End: Original strand, 2459031 - 2459278
Alignment:
| Q |
4 |
cactgctttttgtgatactgattggaaatccataggtgcctatattgtctatcttggtccaaatgcagtttcgtggtcttgcaagaaacaatatacgatt |
103 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2459031 |
cactgctttttgtgatactgattgtaaatccatatgtgcctatattgtctatcttggtccaaatgcagtttcgtggtcttgcaagaaacaatatacgatt |
2459130 |
T |
|
| Q |
104 |
cctcaatcctctacaaattaaaggatgaatatcgaaccattggtttaaccaccacataattactctggccacgacaactactctatcaactctctcaact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
2459131 |
cctcaatcctctacaaattaaaggatgaatatcgaaccattggtttaaccaccacataattactctggccatgaaaactactctatcaactctctcaact |
2459230 |
T |
|
| Q |
204 |
gtcaaccatttacacagaaaaattggagccaactaccaatgtgcaaat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2459231 |
gtcaaccatttacacagaaaaattggagccaactaccaatgtgcaaat |
2459278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 21 - 95
Target Start/End: Complemental strand, 19731023 - 19730949
Alignment:
| Q |
21 |
ctgattggaaatccataggtgcctatattgtctatcttggtccaaatgcagtttcgtggtcttgcaagaaacaat |
95 |
Q |
| |
|
||||| ||||||| | |||||| |||||||| |||||||||||||| ||| |||| ||||| ||||||||||||| |
|
|
| T |
19731023 |
ctgataggaaatctacaggtgcttatattgtgtatcttggtccaaacgcaatttcatggtcgtgcaagaaacaat |
19730949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University