View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15702_high_3 (Length: 237)
Name: NF15702_high_3
Description: NF15702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15702_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 3810807 - 3810601
Alignment:
| Q |
17 |
aaaatcccttaaaaatgacaaactagctctataaagttcgaaactaggnnnnnnnn--ggtgaacaaagcaagcacaaaacacttgcattgcattctcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810807 |
aaaatcccttaaaaatgacaaactagctctataaagttcgaaactaggaaaaaaaaaaggtgaacaaagcaagcacaaaacacttgcattgcattctcat |
3810708 |
T |
 |
| Q |
115 |
tgtaatcatgctaatgatgcattaaaactttgaagataatctgtgacttcttgaatcagctcagaatcacaacttaattgagtaggtatcccatcttggt |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3810707 |
tgtaatcatgctaatgatgcattaaaactttgaagataatatgtgacttcttgaatcagttcagaatcacaacttaattgagtaggtatcccatcttggt |
3810608 |
T |
 |
| Q |
215 |
tatatag |
221 |
Q |
| |
|
||||||| |
|
|
| T |
3810607 |
tatatag |
3810601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University