View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15702_low_4 (Length: 261)
Name: NF15702_low_4
Description: NF15702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15702_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 30575968 - 30576212
Alignment:
| Q |
1 |
aattcatataaatgttgagcaaaaacaactaccaattccaagagcagaaagttcaaccacattgtacatttttgatagagtcatatgaaaggaaaaactt |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30575968 |
aattcataaaaatgttgagcaaaaacaactaccaattccaagagcagaaagttcaaccgcattgtacatttttgatagagccatatgaaaggaaaaactt |
30576067 |
T |
|
| Q |
101 |
tcccaaccacgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggttggtttcttccataatatcgacgggag |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576068 |
tcccaactgcgacatacagatctggtccgaatctgtgcttgccgagaatgaatgactttgttgtcgtagtggttggtttcttccataatatcgacgggag |
30576167 |
T |
|
| Q |
201 |
ataatacagaggaaggagaacaattatattgaagaaagaaccatt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30576168 |
ataatacagaggaaggagaacaattatattgaagaaagaaccatt |
30576212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University