View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15702_low_7 (Length: 238)
Name: NF15702_low_7
Description: NF15702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15702_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 177; Significance: 2e-95; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 18 - 202
Target Start/End: Original strand, 27803932 - 27804116
Alignment:
| Q |
18 |
cagtcgatctgtgtttgagtgagagagagaccaatacattcgtctgggtcttataagatagaataagaggtatggtcataatttcttcgttcaatcacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27803932 |
cagtcgatctgtgtttgagtgagagagataccaatacattcgtctgggtcttataagatagaataagaggtatggtcataatttcttcgttcaatcacat |
27804031 |
T |
 |
| Q |
118 |
gttttattttctttagatgtcatttcctacgtgtttttcttatactttgtgctcttaaatatccaaaaattaagagatatctcga |
202 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27804032 |
gttttattttttttagatgtcatttcctacgtgtttttcttatactttgtgctcttaaatatccaaaaattaagagatatctcga |
27804116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 114 - 197
Target Start/End: Original strand, 27844158 - 27844241
Alignment:
| Q |
114 |
acatgttttattttctttagatgtcatttcctacgtgtttttcttatactttgtgctcttaaatatccaaaaattaagagatat |
197 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| | ||| ||||||||| ||||||||| |
|
|
| T |
27844158 |
acatgttttattttgtttagatatcatttcctacgtgtttttcttatactttgtgctcgtgaatgtccaaaaatcaagagatat |
27844241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 114 - 202
Target Start/End: Complemental strand, 27843572 - 27843484
Alignment:
| Q |
114 |
acatgttttattttctttagatgtcatttcctacgtgtttttcttatactttgtgctcttaaatatccaaaaattaagagatatctcga |
202 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||||||||||||||||| | | ||| |||||||||||||||||||||||| |
|
|
| T |
27843572 |
acatgttttattttgtttagatatgatttcctacgtgtttttcttatactttgtgattgtgaatgtccaaaaattaagagatatctcga |
27843484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 238
Target Start/End: Original strand, 27805469 - 27805506
Alignment:
| Q |
201 |
gaaacatttaatgttttcttaataactcatgcaggaaa |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27805469 |
gaaacatttaatgttttcttaataactcatgcaggaaa |
27805506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 234
Target Start/End: Original strand, 27812921 - 27812954
Alignment:
| Q |
201 |
gaaacatttaatgttttcttaataactcatgcag |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27812921 |
gaaacatttaatgttttcttaataactcatgcag |
27812954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University