View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15703_low_15 (Length: 270)
Name: NF15703_low_15
Description: NF15703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15703_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 78 - 250
Target Start/End: Complemental strand, 43094911 - 43094739
Alignment:
| Q |
78 |
acggccgcgcctgtagcaacagctgtggctagaatcaatgaaaaggcttgtttgtcctgttcattctctgcatcagttttctttggtttaacttcttctt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43094911 |
acggccgcgcctgtagcaacagctgtggctagaatcaatgaaaaggcttgtttgtcctgttcattctctgcatcagttttctttggtttaacatcttctt |
43094812 |
T |
|
| Q |
178 |
ttggaggaagagatggaaccggaacaacagttattggtgatactcctccagatttccactcagcatcctcata |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43094811 |
ttggaggaagagatggaaccggaacaacagttattggtgatactcctccagatttccactcagcatcctcata |
43094739 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University