View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15703_low_17 (Length: 256)
Name: NF15703_low_17
Description: NF15703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15703_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 244
Target Start/End: Original strand, 30808473 - 30808699
Alignment:
| Q |
18 |
ggattttatcgaaagaagatgaagaaattgaagataaattgtggtgtataaaccctaccaagaaggtttatcacaagaacgattgggaatgatggattgc |
117 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30808473 |
ggattttatcgaacgaagatcaagaaattgaagataaattgtggtgtataaaccctaccaagaaggtttatcacaagaacgattgagaatgatggattgc |
30808572 |
T |
 |
| Q |
118 |
atcaaacgaagaccgtgacattgaagcaaaattgcggtggataaaatgaaggttttgcacaaaattgtgattaatctaagtgagtttcatacatcattct |
217 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30808573 |
atcaaatgaagaccgtgacattgaagcaaaattgtgatggataaaacgaaggttttgcacaaaattgtgattaatctaagtgagtttcatacatcattct |
30808672 |
T |
 |
| Q |
218 |
ttcaacattgtcagtaggagtattatc |
244 |
Q |
| |
|
|||||||||||| |||||||||||||| |
|
|
| T |
30808673 |
ttcaacattgtcggtaggagtattatc |
30808699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University