View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15703_low_19 (Length: 250)
Name: NF15703_low_19
Description: NF15703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15703_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 16 - 236
Target Start/End: Complemental strand, 47193651 - 47193435
Alignment:
| Q |
16 |
ctaatcatctcagaggtcgaatgttccattgaaagtaatcataaggaagnnnnnnnnnttaactttggatttcatccatgcctattccaaaagtttaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47193651 |
ctaatcatctcagaggtcgaatgttccattgaaagtaatcataaggaa----aaaaaattaactttggatttgatccatgcctattccaaaagtttaacc |
47193556 |
T |
 |
| Q |
116 |
atgtcaataagaatatcacttaaacaatcttgataaccaaaaataacatggttgcaatgttttcaaattgagcacatgcaagccaaccaaatcgattgaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
47193555 |
atgtcaataagaatatcacttaaacaatcttgataacaaaaaataacatggttgcaatgttttcaaattgagcacatgcaagccaaccaaatcgaatgaa |
47193456 |
T |
 |
| Q |
216 |
gacaatccttcacttttttcc |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
47193455 |
gacaatccttcacttttttcc |
47193435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University