View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15703_low_20 (Length: 237)
Name: NF15703_low_20
Description: NF15703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15703_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 11375254 - 11375052
Alignment:
| Q |
16 |
aaaatctaaattggcatgttaagcggtgcccattgctgaaacaggttcaatccctgtccgatcaacctttctataaaaaaggtatcaatgctggttctga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11375254 |
aaaatctaaattggcatgttaagcggtgcccattgctgaaacaggttcaatccctgtccgatcaacctttctataaaaaaggtatcaatgctggttctga |
11375155 |
T |
|
| Q |
116 |
tggagaacaacaagaggaggaaacttcagggtttaatgattcaaaattgactactatgaccgtttcttcagaaatgaagaggaatgctcttcatgggatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11375154 |
tggagaacaacaagaggaggaaacttcagggtttaatgattcaaaattgactactatgaccgtttcttcagaaatgaagaggaatgctcttcatgggatg |
11375055 |
T |
|
| Q |
216 |
agt |
218 |
Q |
| |
|
||| |
|
|
| T |
11375054 |
agt |
11375052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University