View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15704_high_13 (Length: 228)
Name: NF15704_high_13
Description: NF15704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15704_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 214
Target Start/End: Original strand, 34365795 - 34366008
Alignment:
| Q |
1 |
tgaagatggtgtatacatcatctatgaagtcattgaaaatggtaatggttaaattgatgacattttttatgctaatagaggtgattacatgccaattcgg |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34365795 |
tgaagatgatgtatacatcatctatgaagtcattgaaaatggtaatggttaaattgatgacattttttatgctaatagaggtgattacatgccaattcgg |
34365894 |
T |
 |
| Q |
101 |
gttcggattcgggggagggttaaacatgaactactatttgatgagttgcccttttgttgaaccagttgttaagaacatagtgaatagagctttggacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34365895 |
gttcggattcgggggagggttaaacatgaactactatttgatgagttgcccttttgttgaaccagttgttaagaacatagtgaatagagctttggacaat |
34365994 |
T |
 |
| Q |
201 |
gatcccacctttgc |
214 |
Q |
| |
|
||||||||| |||| |
|
|
| T |
34365995 |
gatcccacccttgc |
34366008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University