View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15704_high_8 (Length: 326)
Name: NF15704_high_8
Description: NF15704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15704_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 47462625 - 47462475
Alignment:
| Q |
18 |
ccctctccattcacggaagaagatccgatcccattttaatttgggatgcatgttggtaagagagaaaatagattgttttcctcctttaatttggttaggc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
47462625 |
ccctctccattcacggaagaagatccgatcccatttt-----gggatgcatgttggtaagagagaaaatagattgttttcctcc-----tttggttaggc |
47462536 |
T |
|
| Q |
118 |
aacaaaagttttcttctcatatgattgatac---ttaaaattgtggagacttatttgatac |
175 |
Q |
| |
|
|| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47462535 |
aagaaaagttttcttctcatatgattgatactaattaaaattgtggagacttatttgatac |
47462475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 212 - 309
Target Start/End: Complemental strand, 47462438 - 47462341
Alignment:
| Q |
212 |
gtacctgaattctaaaaggtgaccatgtgctagggtcatgaggcatatcatcccaagctataagctgtgcctcatcagatccagtagcagaagatgat |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47462438 |
gtacctgaattctaaaaggtgaccatgtgctagggtcatgaggcatatcatcccaagctataagctgtgcctcatcagatccagtagcagaagatgat |
47462341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University