View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15704_low_13 (Length: 301)
Name: NF15704_low_13
Description: NF15704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15704_low_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 128; Significance: 3e-66; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 164 - 295
Target Start/End: Complemental strand, 31077834 - 31077703
Alignment:
| Q |
164 |
gatttgaaaattataacagggtgcatatcgggatgacaatggaaagcctgtggttttggaatgtgttagagaagcagagagaaggatcgcaggaaaccaa |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31077834 |
gatttgaaaattataacagggtgcatatcgggatgacaatggaaagcctgtggttttggaatgtgttagagaagcagagagaaggatcgcaggaaaccaa |
31077735 |
T |
|
| Q |
264 |
ttcatgtgagtcaaatattattattttcttgg |
295 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
31077734 |
ttcatgtgagtcaaatattattatttttttgg |
31077703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 17 - 99
Target Start/End: Complemental strand, 31077981 - 31077899
Alignment:
| Q |
17 |
gaaatgaagtgatccaatgtaataccataacatagcaacactgttctatcgttttttatcatcagatttataattcgtgcgat |
99 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31077981 |
gaaatgaaatgatccaatgtaataccataacatagcaacactgttctatcgttttttatcatcagatttataattcgtgcgat |
31077899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 31069327 - 31069253
Alignment:
| Q |
204 |
ggaaagcctgtggttttggaatgtgttagagaagcagagagaaggatcgcaggaaaccaattcatgtgagtcaaa |
278 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| || || ||||||||||||||||||||||||||| |
|
|
| T |
31069327 |
ggaaagccagtggttttggaatgtgttagagaagctgagaggagaattgcaggaaaccaattcatgtgagtcaaa |
31069253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University