View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15704_low_14 (Length: 297)
Name: NF15704_low_14
Description: NF15704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15704_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 5e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 40 - 239
Target Start/End: Complemental strand, 34366280 - 34366081
Alignment:
| Q |
40 |
gtgcagacctaatcttcacttaattaaacctaatccaaaattataagacaatatcaaatctatcaaaaatttatcaaaacttgcattacaactaatttga |
139 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34366280 |
gtgcagacctaatcttcactcaattaaacctaatccaaaattataagatggcatcagatctatcaaaaatttatcaaaacttgcattacaactaatttga |
34366181 |
T |
|
| Q |
140 |
atatatactataaaacattaatttcaaagtggaccatgcatgtacgcatgcaacatcatcatgcatccaccatgtgtttgagtgtctcatgctagaatgt |
239 |
Q |
| |
|
|| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34366180 |
atgtatactataaaacattaatttccaagtggaccatgcatgtacgcatgcaacatcatcatgcatccaccatgtgtttgagtgtctcatgctagaatgt |
34366081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 267 - 297
Target Start/End: Complemental strand, 34366053 - 34366023
Alignment:
| Q |
267 |
acctgtatgaagcagtcatggaagtgcattc |
297 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34366053 |
acctgtatgaagcagtcatggaagtgcattc |
34366023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University