View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15704_low_6 (Length: 400)
Name: NF15704_low_6
Description: NF15704
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15704_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 373; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 373; E-Value: 0
Query Start/End: Original strand, 18 - 394
Target Start/End: Complemental strand, 40383340 - 40382964
Alignment:
| Q |
18 |
attattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatcttttaccgtcttgacgattcaccaaaaggtgttcaagagcgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383340 |
attattcggaatccgtctcggtgcagttctggttaccggaggaatcttggccaccatcttttaccgtcttgacgattcaccaaaaggtgttcaagagcgt |
40383241 |
T |
 |
| Q |
118 |
ttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagctatccccgttttccttcaagagcgttacattttcatgagagaaactg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383240 |
ttgggtttcttcgcctttgccatgtcaacaaccttctacacttgtgctgaagctatccccgttttccttcaagagcgttacattttcatgagagaaactg |
40383141 |
T |
 |
| Q |
218 |
cttacaacgcttaccgtcgttcttcctatgtccttgcacactccatcatctctctccctgcactcatcttcctctccttcgccttctccgtcaccacttt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40383140 |
cttacaacgcttaccgtcgttcttcctatgtccttgcacactccatcatctctctccctgcactcatcttcctctccttcgccttctccgtcaccacttt |
40383041 |
T |
 |
| Q |
318 |
ttggtctgttggacttgccggcgggacatctggtttcctcttttactttttcaccattttagcttccttctgtgctg |
394 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40383040 |
ttggtctgttggacttgccggcgggacatctggtttcctcttttactttttcaccattttagcttccttctgggctg |
40382964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University