View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_high_28 (Length: 247)
Name: NF15705_high_28
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 4332214 - 4332458
Alignment:
| Q |
1 |
agatatctgataaaatttaattcggactcggtaccagaaatgtcatctatcgtcacatgttttgcacccggaatggcacggccgacctcgaaaagatatc |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4332214 |
agatatctgataaaatttaattcgaactcggtaccagaaatgtcatctatcatcacatgttttgcacccggaatggcacggccgacctcgaaaagatatc |
4332313 |
T |
 |
| Q |
101 |
ttcccaacaataggtggcaaggtgtcaaagggacagtatgcatatcagtccgcagtgc-------------------atccatggattaaagggggaaat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4332314 |
ttcccaacaataggtggcaaggtgtcaaagggacagtatgcatatcagtccgcagtgcctacatgcaattgttacaaatccatggattaaagggggaaat |
4332413 |
T |
 |
| Q |
182 |
atagcatgcataagagagatataatggtctgaaggtaacattgtatt |
228 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
4332414 |
atagcatgcata--agagatataatggtctgaaggtaacattgtatt |
4332458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 5 - 138
Target Start/End: Original strand, 4333611 - 4333741
Alignment:
| Q |
5 |
atctgataaaatttaattcggactcggtaccagaaatgtcatctatcgtcacatgttttgcacccggaatggcacggccgacctcgaaaagatatcttcc |
104 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||| ||| |||||||||||||||| | |||| |||||||||| | || ||| ||| ||||||||||| |
|
|
| T |
4333611 |
atctgatcaaatttaattcagactgggtaccagagatgccatctatcgtcacatg--tcgcactcggaatggcatgaccagccttgaagagatatcttcc |
4333708 |
T |
 |
| Q |
105 |
caacaataggtggcaaggtgtcaaagggacagta |
138 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
4333709 |
caacaataggtggc-aggtgtcaaagggacagta |
4333741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University