View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_high_32 (Length: 239)
Name: NF15705_high_32
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_high_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 19 - 238
Target Start/End: Original strand, 31882064 - 31882283
Alignment:
| Q |
19 |
tttggacctaagactaaaagaaaacgtccaagccttttggcttctgattatgagtctttagctaaaaaagctgatgtttctcaagatgcttttgaagatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31882064 |
tttggacctaagactaaaagaaaacgtccaagccttttggcttctgattatgagtctttagctaaaaaagctgatgtttctcaagatgcttttgaagatg |
31882163 |
T |
|
| Q |
119 |
gcaatgaagctgatgatggatttagagatttagtgcgacataccatgtttgaaaagggtcaaagcaaacgcatatggggtgagctctacaaggtgataga |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31882164 |
gcaatgaagctgatgatggatttagagatttagtgcgacataccatgtttgaaaagggtcaaagcaaacgcatatggggtgagctctacaaggtgataga |
31882263 |
T |
|
| Q |
219 |
ttcttcagatgttgttgtgc |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31882264 |
ttcttcagatgttgttgtgc |
31882283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 188
Target Start/End: Original strand, 43141234 - 43141270
Alignment:
| Q |
152 |
tgcgacataccatgtttgaaaagggtcaaagcaaacg |
188 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
43141234 |
tgcgacataccatgtttgacaagggccaaagcaaacg |
43141270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 133 - 236
Target Start/End: Complemental strand, 33480655 - 33480552
Alignment:
| Q |
133 |
gatggatttagagatttagtgcgacataccatgtttgaaaagggtcaaagcaaacgcatatggggtgagctctacaaggtgatagattcttcagatgttg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
33480655 |
gatggatttagagatttagtgcgacataccatgtttgaaaagggtcaaagcaaacgtatatggggtgaactttacaaagtgatagattcttcagatgttg |
33480556 |
T |
|
| Q |
233 |
ttgt |
236 |
Q |
| |
|
|||| |
|
|
| T |
33480555 |
ttgt |
33480552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 17 - 103
Target Start/End: Complemental strand, 33481418 - 33481332
Alignment:
| Q |
17 |
catttggacctaagactaaaagaaaacgtccaagccttttggcttctgattatgagtctttagctaaaaaagctgatgtttctcaag |
103 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
33481418 |
catttggacctaagactaaaagaaagcgtccaagtcttttggcttctgattatgagtctttagctaagaaagccgatggttctcaag |
33481332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University