View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_high_34 (Length: 238)
Name: NF15705_high_34
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 44849091 - 44849313
Alignment:
| Q |
1 |
tcatgccagaaagagatgccaatggaaatatcattgtaagaccatacggtagagtgtacgttacaatactttgtttttctttcaatacttatgtaagtta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44849091 |
tcatgccagaaagagatgccaatggaaatatcattgtaagaccatacggtagagtgtaagttacaatactttgtttttctttcaatacttatttaagtta |
44849190 |
T |
|
| Q |
101 |
taatatttacttaatattttgtttctttaaataatttacaggctcactctcctag-aatgcagttgttgatgatgtcattaagagtgccacacacagttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
44849191 |
caatatttacttaatattttgtttctttaaataatttacaggctcactctcctagcaatgcagttgttgatgatgtcattaagagcgccagacacagttt |
44849290 |
T |
|
| Q |
200 |
gtggttcttagtcttaccattgt |
222 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
44849291 |
gtggtccttagtcttaccattgt |
44849313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University