View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_26 (Length: 315)
Name: NF15705_low_26
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 72 - 298
Target Start/End: Complemental strand, 44606244 - 44606015
Alignment:
| Q |
72 |
taattttgtaacactgtctagaactcttctaattcatccat---tttactatttagatgggagtgcagatgggagtggaagtgaatattctgatgagcaa |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606244 |
taattttgtaacactgtctagaactcttctaattcattcataattttactatttagatgggagtgcagatgggagtggaagtgaatattctgatgagcaa |
44606145 |
T |
 |
| Q |
169 |
gatagaaatgatgataactctgaagatgagaatgacgcattcttcgatacatatgaaattctaacaacaagttctattagaagtaatgaatctgaggaga |
268 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44606144 |
gatagaaatgatgataactccgaagatgagaatgatgcattcttcgatacatatgaaattctaacaacaagttctattagaagtaatgaatctgaggaga |
44606045 |
T |
 |
| Q |
269 |
catccagtagtccaactattggatctaact |
298 |
Q |
| |
|
||||||||| |||||||||||||||||||| |
|
|
| T |
44606044 |
catccagtaatccaactattggatctaact |
44606015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 44606341 - 44606264
Alignment:
| Q |
1 |
aggatgaaggggagtcttatctatcaacacatgaagaagatagtggtatgtttagagagatcaatattccataatttt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
44606341 |
aggatgaaggggagtcttatctatcaacacatgaagaagatagtggtatgtttagagagataaatattccatactttt |
44606264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University