View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_27 (Length: 313)
Name: NF15705_low_27
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 278
Target Start/End: Complemental strand, 44206800 - 44206530
Alignment:
| Q |
7 |
tgtcgaagaatataatatcatgttttttaataactcca--tcttttttctttcaattaattactatgttcctatgcttttgtgtcacttttcttgatacc |
104 |
Q |
| |
|
||||||| | ||||||| ||| ||| ||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44206800 |
tgtcgaatagtataatagcattgtttgtaataactccacatcttttttctttcaattaatta---tgttcctatgcttttgtgtcacttttcttgatacc |
44206704 |
T |
 |
| Q |
105 |
tattaaaaagaaactcatattaacgactttgtttcgatgtatatagaatatgtggtatcattatcaatcttgttatatggttgattccataattaccttt |
204 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44206703 |
tattaaaaagaaactcatattgacgactttgtttcgatgtatatagaatatgtggtatcattatcaatcttgttatatggttgattccataattaccttt |
44206604 |
T |
 |
| Q |
205 |
gaataggccaatttttgtctacttcttgtatgtaagttgattgatgagtttaggtcacttattattattattat |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
44206603 |
gaataggccaatttttgtctacttcttgtatgtaagttgattgatgaatttaggtcacttattattattattat |
44206530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University