View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_35 (Length: 241)
Name: NF15705_low_35
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_35 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 224
Target Start/End: Original strand, 40859867 - 40860088
Alignment:
| Q |
21 |
atattaaacttattcacttgttgcattaattcaataccaaggcaccctgttaggtaaccatttatg------------------tgtaataatcggaatc |
102 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
40859867 |
atattaaacttcttcacttgttgcattaattcaataccaaggcaccctgttaggtaaccatttatgatttcaaaaccttgtatgtgtaataatcggaatc |
40859966 |
T |
 |
| Q |
103 |
cgaaaaaagtgtcagaatttaatcagttaaaatataactttaatgatgcaaagttaacgaaccttgttcatctggctcagacagaccaggaattctccct |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40859967 |
tgaaaaaagtgtcagaatttaatcagttaaaatataactttaatgatgcaaagttaacgaaccttgttcatctggctcagacagaccaggaattctccct |
40860066 |
T |
 |
| Q |
203 |
gctaaaagaccttgtttcacca |
224 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
40860067 |
gctaaaagaccttgtttcacca |
40860088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University