View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_36 (Length: 240)
Name: NF15705_low_36
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 43885565 - 43885359
Alignment:
| Q |
16 |
atgaacatacgaggatcaaacatttatgaatgtttttgaatgttaccatattattggtaggaaaattacattgctgcgggagagacatagatgtagcttt |
115 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43885565 |
atgaacatgcgaggatcaaacatttatgaatgtttttgaatgttaccatattattggtaggaaaatgacattgctgcgggagagacatagatgtagcttt |
43885466 |
T |
 |
| Q |
116 |
tactctttcaacaagttttttattttctcaccatgcaagattgggagatcgaacacttaaccatttattcaaaggactcacttacatctttatcatttag |
215 |
Q |
| |
|
|||||||| |||||| |||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43885465 |
tactctttaaacaagatttttattttctcaccgtgcaagattaggagatggaacacttaaccatttattcaaaggactcacttacatctttatcatttag |
43885366 |
T |
 |
| Q |
216 |
atcttgt |
222 |
Q |
| |
|
||||||| |
|
|
| T |
43885365 |
atcttgt |
43885359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University