View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_41 (Length: 236)
Name: NF15705_low_41
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 3811170 - 3810966
Alignment:
| Q |
16 |
ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811170 |
ctgtgaagcgtgaggttatgcatgtgctgaagatgtgtttcaatggaatatagctcattaatgtaattttcatggatattgataacttcaaccgataaca |
3811071 |
T |
 |
| Q |
116 |
aacccttttaagagtaatgaatttgtggttaatcgtttaatttattgtctttattttctttttaagggtacctgttatgttccacattcttttaatgttt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3811070 |
aacccttttaagagtaatgaatttgtggttaatcgtttaatttattgtttttattttctttttaagggtacctgttatgttccacattcttttaatgttt |
3810971 |
T |
 |
| Q |
216 |
ttatg |
220 |
Q |
| |
|
||||| |
|
|
| T |
3810970 |
ttatg |
3810966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University