View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_46 (Length: 221)
Name: NF15705_low_46
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 203
Target Start/End: Complemental strand, 41160692 - 41160510
Alignment:
| Q |
16 |
atgaactatgtggaactcctgtgagaacaacaaatcagcttgttatcgttgaactcaaacttagagatcgtcgtttcaccattcgatactaacttaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41160692 |
atgaactatgtggaactcctgtgagaacaacaa-tcagcttgttatcgttgaactcaaacttagagatcgtcgtttcaccattcgatactaactta---- |
41160598 |
T |
 |
| Q |
116 |
ccttcatatctagttcttatcttacttctactaaagccgactgtgtaaaatgttagttttgtcagcgttcatgttgggtctatgtttt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41160597 |
ccttcatatctagttcttatcttacttctactaaagctgactgtgtaaaatgttagttttgtcagcgttcatgttgggtctatgtttt |
41160510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University