View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15705_low_47 (Length: 220)
Name: NF15705_low_47
Description: NF15705
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15705_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 18 - 178
Target Start/End: Complemental strand, 37173318 - 37173158
Alignment:
| Q |
18 |
ccaagcaattttataatatacctttttagtgctctttttccttttcatatatccggattaataattaaactaatgtaaatgttgagcttgagattgacta |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
37173318 |
ccaagcaatttcataatatacctttttagtgctctttttccttttcatatatccggattaataattaaactaatgtaaattttgagcttgaaattgacta |
37173219 |
T |
|
| Q |
118 |
tggagattagaatcacaacaagtatcgcaacaacaatcacacgcatactgttaagaatgat |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37173218 |
tggagattagaatcacaacaagtatcgcaacaacaattacacgcatactgttaagaatgat |
37173158 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University