View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15706_high_8 (Length: 229)
Name: NF15706_high_8
Description: NF15706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15706_high_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 82 - 216
Target Start/End: Original strand, 18656072 - 18656206
Alignment:
| Q |
82 |
cttatccatgtcaaacctatgtttactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgat |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18656072 |
cttatccatgtcaaacctatgtttactacaaagcaacaccaccaaattacctcgatttagctaccatttcagaccttttccaacttagtcgtttaatgat |
18656171 |
T |
 |
| Q |
182 |
ctcaaaaccaagcaatatctcttcaccttcatctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
18656172 |
ctcaaaaccaagcaatatctcttcaccttcttctc |
18656206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University