View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15706_low_10 (Length: 250)

Name: NF15706_low_10
Description: NF15706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15706_low_10
NF15706_low_10
[»] chr5 (1 HSPs)
chr5 (17-250)||(39771510-39771743)


Alignment Details
Target: chr5 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 39771743 - 39771510
Alignment:
17 gaattaggggtacgggaactcctcagattggtggagggggcaaggctagagaggctttgtggcagaggttggggaattgtatggatcagttgcattccat 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39771743 gaattaggggtacgggaactcctcagattggtggagggggcaaggctagagaggctttgtggcagaggttggggaattgtatggatcagttgcattccat 39771644  T
117 tactgtggctgtgtggcatttgcagagggtgctttcgaagaaacgggatccctttactcatgttttgttgcttgatgaggttattcaggtgaggagagga 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39771643 tactgtggctgtgtggcatttgcagagggtgctttcgaagaaacgggatccctttactcatgttttgttgcttgatgaggttattcaggtgaggagagga 39771544  T
217 actttctcatccatattttgtagccatgtttcat 250  Q
    ||||||||||||||||||||||||||||||||||    
39771543 actttctcatccatattttgtagccatgtttcat 39771510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University