View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15706_low_9 (Length: 288)
Name: NF15706_low_9
Description: NF15706
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15706_low_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 267
Target Start/End: Complemental strand, 26855255 - 26855004
Alignment:
| Q |
16 |
gcaacaaaagtgctgagaatgtgtgacttaagggattgtcaccataaaatatgccattagggtgaaagttttgtgcttgacacaaaatttgttcttgtag |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26855255 |
gcaacagaagtgctgagaatgtgtgacttaagggattgtcaccataaaatatgccattagggtgaaagttttgtgcttgacacaaaatttgttcttgtag |
26855156 |
T |
|
| Q |
116 |
aacacgagaaggaatagaatgtgcatgttgttgccattcattttttggtgtttgtagcaaacgatttgcagggaatagccgagtcatgcatgaatatttt |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26855155 |
aacacgagaaggaatagaatgtgcatgttgttgccattcattttttggtgtttgtagcaaacgatttgcagggaatagccgagtcatgcatgaatttttt |
26855056 |
T |
|
| Q |
216 |
tgataataaacatgaacgttcgaaattacacatgaagaatgtgtgcttgttt |
267 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
26855055 |
tgataataaacatgaacattcaaaattacacatgaagaatgtgtgcttgttt |
26855004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University