View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_high_12 (Length: 320)
Name: NF15707_high_12
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_high_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 9 - 320
Target Start/End: Original strand, 47592303 - 47592614
Alignment:
| Q |
9 |
tccaagaatattacaccccctatttagttcaacctgtcttttaaactggaatgacttattcttatatgatttcatgcatacattgttttgtagaacttaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592303 |
tccaagcatattacaccccctatttagttcaacctgtcttttaaactggaatgacttattcttaaatgatttcatgcatacattgttttgtagaacttaa |
47592402 |
T |
 |
| Q |
109 |
atatcagatgtctgataaatctatacaaagatgcgttcataattttgatcatttgtgcctattaattaccttcaggcctgatcacaatctgcaagatatt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592403 |
atatcagatgtctgataaatctatacaaagacgcattcataattttgatcatttgtgcctattaattaccttcaggcctgatcacaatctgcaagatatt |
47592502 |
T |
 |
| Q |
209 |
aggaccaaaatattcccttgtaaacgacaaaaggttaaagccgaagaagttgttccctcaacacccctgccaccaaaaaggaaggaaagatcactttcat |
308 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47592503 |
aggaccaaaatattcccatgtaaacgacaaaaggttaaagccgaagaagttgttccctcaacacccctgccaccaaaaaggaaggaaagatcactttcat |
47592602 |
T |
 |
| Q |
309 |
cattggtggtca |
320 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47592603 |
cattggtggtca |
47592614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University