View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_high_15 (Length: 301)
Name: NF15707_high_15
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 13 - 219
Target Start/End: Complemental strand, 16201628 - 16201422
Alignment:
| Q |
13 |
gcataggccaagagggaaggtgactgagagtgaagaagtgaagaggaggttaggaggttgggatgatgagattaaagatggggagtttggtaaaggtatg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16201628 |
gcataggccaagagggaaggtgactgagagtgaagaagtgaagaggaggttaggaggttgggatgatgagattaaagatggggagtttggtaaaggtatg |
16201529 |
T |
|
| Q |
113 |
gttgatatggttaaagaaactgttggatcttggtttgggaaaccaggggaaaatgaatcaactcaaggttagtactttgtgacttcatttctttatttat |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16201528 |
gttgatatggttaaggaaactgttggatcttggtttgggaaaccaggggaaaatgaatcaactcaaggttagtactttgtgacttcatttctttatttat |
16201429 |
T |
|
| Q |
213 |
gattcat |
219 |
Q |
| |
|
||||||| |
|
|
| T |
16201428 |
gattcat |
16201422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 225 - 281
Target Start/End: Complemental strand, 16201310 - 16201254
Alignment:
| Q |
225 |
taaaactaatagactaggaagagtttgtacaagtgttttgctgtgattttgagacat |
281 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
16201310 |
taaaactaatagactaagaagagtttgtacaagtgttttgctgtaattttgatacat |
16201254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University