View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF15707_low_10 (Length: 372)
Name: NF15707_low_10
Description: NF15707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF15707_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 204 - 364
Target Start/End: Complemental strand, 26005905 - 26005745
Alignment:
| Q |
204 |
taggttagatcttcgatttcgatcttcatggatagcataatgaacaagcttcgtaatctcgatgcatatccaaaaatcaatgaagatttctatagtcgca |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26005905 |
taggttagatcttcgatttcgatcttcatggatagcataatgaacaagcttcgtaatctcgatgcatatccaaaaatcaatgaagatttctatagtcgca |
26005806 |
T |
|
| Q |
304 |
ctctttctggcggtcttatcactatcgtttcttccattctcatgctattgcttttcttctc |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26005805 |
ctctttctggcggtcttatcactatcgtttcttccattctcatgctattgcttttcttctc |
26005745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 19 - 140
Target Start/End: Complemental strand, 26006096 - 26005975
Alignment:
| Q |
19 |
gtatttggccaacaaaatatttaaaagtcattcatacctctgcttcaaccaaatcgcgaaacgccccgttccagttgttagagcaaatctcaaacaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26006096 |
gtatttggccaacaaaatatttaaaagtcattcatacctctgcttcaaccaaatcgcgaaacgccccgttccagttgttagagcaaatctcaaacaaaat |
26005997 |
T |
|
| Q |
119 |
ttggattgaacggggtgtttat |
140 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26005996 |
ttggattgaacggggtgtttat |
26005975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University